DNA Cryptography

Last Updated : 11 Jul, 2025

Cryptography is the branch of science that deals with the encoding of information to hide messages. It plays a vital role in the infrastructure of communication security. The Pioneering work had been done by Ashish Gehani et al and Amin et al after Leonard Max Adleman had shown the capability of molecular computation in 1994. This paved the way for DNA Computing. DNA Cryptology combines cryptology and modern biotechnology.

Why DNA Cryptography?

  • DNA Cryptography is one of the rapidly evolving technologies in the world. 
  • Adelman showed the world how it can be used to solve complex problems like the directed Hamilton path problem and NP-complete problem (for example Travelling Salesman problem). Hence users can design and implement more complex Crypto algorithms. 
  • It brings forward new hope to break unbreakable algorithms. This is because DNA computing offers more speed, minimal storage, and power requirements. 
  • DNA stores memory at a density of about 1 bit/nm3 whereas conventional storage media requires 1012 nm3/bit. 
  • No power is required for DNA computing while the computation is taking place. 
  • Surprisingly, one gram of DNA contains 1021 DNA bases which are equivalent to 108 TB of data. Hence can store all the data in the world in a few milligrams.  

DNA Cryptography can be defined as hiding data in terms of DNA Sequence. Just like the RSA and DES algorithms, in DNA Cryptology users have DNA algorithms like “Public-key system using DNA as a one-way function for key distribution,” “DNASC cryptography system”, DNA Steganography Systems, Triple stage DNA Cryptography, Encryption algorithm inspired by DNA and Chaotic computing. 

So, how do encode data in a DNA strand which is mainly made, up of 4 nitrogenous bases namely: 

  1. Adenine (A) 
  2. Thymine (T) 
  3. Cytosine (C) 
  4. Guanine (G)  

The easiest way to encode is to represent these four units as four figures: 

A(0) –00
T(1) –01
C(2)–10
G(3)–11

  • By these encoding rules, there are 4!=24 possible encoding methods. Based on some principles as A and G make pairs while T and C make pairs. 
  • Of those 24 methods, only 8 matches the DNA pairing rule but the best encoding scheme is 0123/CTAG.  

So now converted our initial number into a sequence of A, T, G, and C theoretically. This is then physically implemented using various DNA synthesizing techniques like Chemical Oligonucleotide Synthesis and Oligo Synthesis Platforms (this includes column-based Oligo Synthesis, Array-based Oligo Synthesis, Complex Strand and Gene Synthesis and Error Correction). 
Let’s take an example of the classic XOR One Time Pad and see how its implemented using DNA Cryptography: 
Example - Let M be the message and K be the key. The Ciphertext is obtained by finding M xor K = C. User can again obtain the Encoded message by doing: C xor K = M xor K xor K= M. Hence, get our original message. The steps involved in implementing it is:

  1. The message and the OTP key are converted to ASCII bits 
  2. Zero Padding is added to the message and the key in order to make the size of their binary codes even 
  3. The message and the key are XORed together 
  4. The XOR output is represented in DNA bases format. This is our enciphered text.  

The decryption process involves the following processes and hence it is also prone to eavesdropping: 

  1. All the DNA bases are transformed into bits. 
  2. These bits are then XORed with the OTP key bits to reproduce the original plain text. 
  3. This text so obtained in binary format is then converted into a sequence of ASCII characters.

Similarly, users can implement other crypto algorithms like AES and even DES. Instead of storing data as a sequence of 0s and 1s, storing them as a sequence of nitrogenous bases. Storing information in the form of DNA enables us to store a lot of data in a small area. 

Here's an example of DNA cryptography that demonstrates the encoding and decoding of a message using a simple substitution cipher:

C++
#include <bits/stdc++.h>
using namespace std;

// Define the corrected DNA encoding and 
// decoding dictionaries with unique mappings
unordered_map<char, string> encodingDict = {
    {'A', "AAA"}, {'B', "AAC"}, {'C', "AAG"}, {'D', "AAT"},
    {'E', "ACA"}, {'F', "ACC"}, {'G', "ACG"}, {'H', "ACT"},
    {'I', "AGA"}, {'J', "AGC"}, {'K', "AGG"}, {'L', "AGT"},
    {'M', "ATA"}, {'N', "ATC"}, {'O', "ATG"}, {'P', "ATT"},
    {'Q', "CAA"}, {'R', "CAC"}, {'S', "CAG"}, {'T', "CAT"},
    {'U', "CCA"}, {'V', "CCC"}, {'W', "CCG"}, {'X', "CCT"},
    {'Y', "CGA"}, {'Z', "CGC"}, {' ', "CGG"}
};

unordered_map<string, char> decodingDict;

// Function to initialize decoding dictionary
void initializeDecodingDict() {
    for (auto& pair : encodingDict) {
        decodingDict[pair.second] = pair.first;
    }
}

// Function to encrypt a message using DNA encoding
string encrypt(string message) {
    string encrypted = "";
    for (char c : message) {
        if (encodingDict.find(c) != encodingDict.end()) {
            encrypted += encodingDict[c];
        } else {

            // If character is not in encodingDict
            // Placeholder for unknown characters
            encrypted += "XXX";
        }
    }
    return encrypted;
}

// Function to decrypt a DNA-encoded message
string decrypt(string encrypted) {
    string decrypted = "";

    // Read in chunks of 3
    for (size_t i = 0; i < encrypted.length(); i += 3) {
        string triplet = encrypted.substr(i, 3);
        if (decodingDict.find(triplet) != decodingDict.end()) {
            decrypted += decodingDict[triplet];
        } else {
            // Placeholder for unknown sequences
            decrypted += "?";
        }
    }
    return decrypted;
}

int main() {
    initializeDecodingDict(); // Initialize decoding dictionary

    string message = "HELLO WORLD";
    cout << "Original Message: " << message << endl;

    // Encryption
    string encryptedMessage = encrypt(message);
    cout << "Encrypted Message: " << encryptedMessage << endl;

    // Decryption
    string decryptedMessage = decrypt(encryptedMessage);
    cout << "Decrypted Message: " << decryptedMessage << endl;

    return 0;
}
Java
import java.util.HashMap;
import java.util.Map;

class GfG {

    // Define the corrected DNA encoding and 
    // decoding dictionaries with unique mappings
    static Map<Character, String> encodingDict = new HashMap<>();
    static Map<String, Character> decodingDict = new HashMap<>();

    static {
        encodingDict.put('A', "AAA"); encodingDict.put('B', "AAC"); encodingDict.put('C', "AAG"); encodingDict.put('D', "AAT");
        encodingDict.put('E', "ACA"); encodingDict.put('F', "ACC"); encodingDict.put('G', "ACG"); encodingDict.put('H', "ACT");
        encodingDict.put('I', "AGA"); encodingDict.put('J', "AGC"); encodingDict.put('K', "AGG"); encodingDict.put('L', "AGT");
        encodingDict.put('M', "ATA"); encodingDict.put('N', "ATC"); encodingDict.put('O', "ATG"); encodingDict.put('P', "ATT");
        encodingDict.put('Q', "CAA"); encodingDict.put('R', "CAC"); encodingDict.put('S', "CAG"); encodingDict.put('T', "CAT");
        encodingDict.put('U', "CCA"); encodingDict.put('V', "CCC"); encodingDict.put('W', "CCG"); encodingDict.put('X', "CCT");
        encodingDict.put('Y', "CGA"); encodingDict.put('Z', "CGC"); encodingDict.put(' ', "CGG");

        for (Map.Entry<Character, String> entry : encodingDict.entrySet()) {
            decodingDict.put(entry.getValue(), entry.getKey());
        }
    }

    // Function to encrypt a message using DNA encoding
    static String encrypt(String message) {
        String encrypted = "";
        for (char c : message.toCharArray()) {
            if (encodingDict.containsKey(c)) {
                encrypted += encodingDict.get(c);
            } else {
                // If character is not in encodingDict
                // Placeholder for unknown characters
                encrypted += "XXX";
            }
        }
        return encrypted;
    }

    // Function to decrypt a DNA-encoded message
    static String decrypt(String encrypted) {
        String decrypted = "";

        // Read in chunks of 3
        for (int i = 0; i < encrypted.length(); i += 3) {
            String triplet = encrypted.substring(i, Math.min(i + 3, encrypted.length()));
            if (decodingDict.containsKey(triplet)) {
                decrypted += decodingDict.get(triplet);
            } else {
                // Placeholder for unknown sequences
                decrypted += "?";
            }
        }
        return decrypted;
    }

    public static void main(String[] args) {
        String message = "HELLO WORLD";
        System.out.println("Original Message: " + message);

        // Encryption
        String encryptedMessage = encrypt(message);
        System.out.println("Encrypted Message: " + encryptedMessage);

        // Decryption
        String decryptedMessage = decrypt(encryptedMessage);
        System.out.println("Decrypted Message: " + decryptedMessage);
    }
}
Python
# Define the corrected DNA encoding and 
# decoding dictionaries with unique mappings
encodingDict = {
    'A': 'AAA', 'B': 'AAC', 'C': 'AAG', 'D': 'AAT',
    'E': 'ACA', 'F': 'ACC', 'G': 'ACG', 'H': 'ACT',
    'I': 'AGA', 'J': 'AGC', 'K': 'AGG', 'L': 'AGT',
    'M': 'ATA', 'N': 'ATC', 'O': 'ATG', 'P': 'ATT',
    'Q': 'CAA', 'R': 'CAC', 'S': 'CAG', 'T': 'CAT',
    'U': 'CCA', 'V': 'CCC', 'W': 'CCG', 'X': 'CCT',
    'Y': 'CGA', 'Z': 'CGC', ' ': 'CGG'
}

decodingDict = {v: k for k, v in encodingDict.items()}

# Function to encrypt a message using DNA encoding
def encrypt(message):
    encrypted = ''
    for char in message:
        if char in encodingDict:
            encrypted += encodingDict[char]
        else:
            # If character is not in encodingDict
            # Placeholder for unknown characters
            encrypted += 'XXX'  
    return encrypted

# Function to decrypt a DNA-encoded message
def decrypt(encrypted):
    decrypted = ''

    # Read in chunks of 3
    for i in range(0, len(encrypted), 3):  
        triplet = encrypted[i:i+3]
        if triplet in decodingDict:
            decrypted += decodingDict[triplet]
        else:
            # Placeholder for unknown sequences
            decrypted += '?'  
    return decrypted
    
if __name__ == "__main__":
    message = "HELLO WORLD"
    print("Original Message:", message)
    
    # Encryption
    encryptedMessage = encrypt(message)
    print("Encrypted Message:", encryptedMessage)
    
    # Decryption
    decryptedMessage = decrypt(encryptedMessage)
    print("Decrypted Message:", decryptedMessage)
C#
using System;
using System.Collections.Generic;

class GfG {
    
    // Define the corrected DNA encoding and 
    // decoding dictionaries with unique mappings
    static Dictionary<char, string> encodingDict = new Dictionary<char, string> {
        {'A', "AAA"}, {'B', "AAC"}, {'C', "AAG"}, {'D', "AAT"},
        {'E', "ACA"}, {'F', "ACC"}, {'G', "ACG"}, {'H', "ACT"},
        {'I', "AGA"}, {'J', "AGC"}, {'K', "AGG"}, {'L', "AGT"},
        {'M', "ATA"}, {'N', "ATC"}, {'O', "ATG"}, {'P', "ATT"},
        {'Q', "CAA"}, {'R', "CAC"}, {'S', "CAG"}, {'T', "CAT"},
        {'U', "CCA"}, {'V', "CCC"}, {'W', "CCG"}, {'X', "CCT"},
        {'Y', "CGA"}, {'Z', "CGC"}, {' ', "CGG"}
    };

    static Dictionary<string, char> decodingDict = new Dictionary<string, char>();

    static GfG() {
        foreach (var pair in encodingDict) {
            decodingDict[pair.Value] = pair.Key;
        }
    }

    // Function to encrypt a message using DNA encoding
    static string Encrypt(string message) {
        string encrypted = "";
        foreach (char c in message) {
            if (encodingDict.ContainsKey(c)) {
                encrypted += encodingDict[c];
            } else {
                // If character is not in encodingDict
                // Placeholder for unknown characters
                encrypted += "XXX";
            }
        }
        return encrypted;
    }

    // Function to decrypt a DNA-encoded message
    static string Decrypt(string encrypted) {
        string decrypted = "";

        // Read in chunks of 3
        for (int i = 0; i < encrypted.Length; i += 3) {
            string triplet = encrypted.Substring(i, Math.Min(3, encrypted.Length - i));
            if (decodingDict.ContainsKey(triplet)) {
                decrypted += decodingDict[triplet];
            } else {
                // Placeholder for unknown sequences
                decrypted += "?";
            }
        }
        return decrypted;
    }

    static void Main() {
        string message = "HELLO WORLD";
        Console.WriteLine("Original Message: " + message);

        // Encryption
        string encryptedMessage = Encrypt(message);
        Console.WriteLine("Encrypted Message: " + encryptedMessage);

        // Decryption
        string decryptedMessage = Decrypt(encryptedMessage);
        Console.WriteLine("Decrypted Message: " + decryptedMessage);
    }
}
JavaScript
// Define the corrected DNA encoding and 
// decoding dictionaries with unique mappings
const encodingDict = {
    A: "AAA", B: "AAC", C: "AAG", D: "AAT",
    E: "ACA", F: "ACC", G: "ACG", H: "ACT",
    I: "AGA", J: "AGC", K: "AGG", L: "AGT",
    M: "ATA", N: "ATC", O: "ATG", P: "ATT",
    Q: "CAA", R: "CAC", S: "CAG", T: "CAT",
    U: "CCA", V: "CCC", W: "CCG", X: "CCT",
    Y: "CGA", Z: "CGC", " ": "CGG"
};

// Create the decoding dictionary
const decodingDict = Object.fromEntries(
    Object.entries(encodingDict).map(([k, v]) => [v, k])
);

// Function to encrypt a message using DNA encoding
function encrypt(message) {
    let encrypted = "";
    for (let char of message) {
        if (encodingDict[char]) {
            encrypted += encodingDict[char];
        } else {
            // If character is not in encodingDict
            // Placeholder for unknown characters
            encrypted += "XXX";
        }
    }
    return encrypted;
}

// Function to decrypt a DNA-encoded message
function decrypt(encrypted) {
    let decrypted = "";

    // Read in chunks of 3
    for (let i = 0; i < encrypted.length; i += 3) {
        let triplet = encrypted.substring(i, i + 3);
        if (decodingDict[triplet]) {
            decrypted += decodingDict[triplet];
        } else {
            // Placeholder for unknown sequences
            decrypted += "?";
        }
    }
    return decrypted;
}

// Driver Code
const message = "HELLO WORLD";
console.log("Original Message:", message);

// Encryption
const encryptedMessage = encrypt(message);
console.log("Encrypted Message:", encryptedMessage);

// Decryption
const decryptedMessage = decrypt(encryptedMessage);
console.log("Decrypted Message:", decryptedMessage);

Output
Original Message: HELLO WORLD
Encrypted Message: ACTACAAGTAGTATGCGGCCGATGCACAGTAAT
Decrypted Message: HELLO WORLD

In this example, the encoding_dict and decoding_dict dictionaries represent the mapping between DNA bases and their corresponding letters (A, T, C, G). The 'encrypt' function takes a message as input and converts each letter to its corresponding DNA base pairs according to the encoding_dict. The 'decrypt' function takes the DNA-encoded message and converts each DNA base pair back to the original letter using the decoding_dict.

This demonstrates the basic idea of DNA cryptography, where the original message is encrypted using DNA encoding (mapping letters to DNA base pairs) and then decrypted back to the original message by reversing the process.

Advantages

  • High level of security: DNA cryptography provides a high level of security due to the complexity of DNA sequences and the difficulty of manipulating and decoding DNA molecules. DNA sequences can be used as cryptographic keys, making them virtually impossible to break using current technology.
  • Large key space: DNA cryptography allows for a large key space, which can make it more difficult for attackers to find the correct key. The key space can be expanded by using longer DNA sequences or by encoding multiple keys in a single DNA molecule.
  • Resistance to attacks: DNA cryptography is resistant to certain types of attacks, such as brute-force attacks and quantum computing attacks. This is due to the inherent complexity of DNA sequences and the difficulty of manipulating them.

Disadvantages

  • Technical complexity: DNA cryptography requires specialized knowledge and equipment to encode and decode messages using DNA molecules. This can make it difficult for non-experts to use and implement DNA cryptography in practical applications.
  • Cost: DNA cryptography can be costly due to the specialized equipment and materials required for encoding and decoding DNA molecules. This can make it less accessible for organizations or individuals with limited resources.
  • Limited application: DNA cryptography is currently limited to certain niche applications, such as military and intelligence operations, due to the technical complexity and cost involved. It may not be suitable for general-purpose encryption needs, such as secure communication or data storage.

Conclusion

DNA cryptography is a novel topic that offers strict levels of security and storage capacity by mixing cryptographic methods with biological processes. Although its cost and complexity limits, its promise in areas like as data storage and secure communication is encouraging. DNA cryptography may become increasingly common and accessible as technology advances.

Comment