Abstract
Viruses and virally derived particles have the intrinsic capacity to deliver molecules to cells, but the difficulty of readily altering cell-type selectivity has hindered their use for therapeutic delivery. Here, we show that cell surface marker recognition by antibody fragments displayed on membrane-derived particles encapsulating CRISPRâCas9 protein and guide RNA can deliver genome editing tools to specific cells. Compared to conventional vectors like adeno-associated virus that rely on evolved capsid tropisms to deliver virally encoded cargo, these Cas9-packaging enveloped delivery vehicles (Cas9-EDVs) leverage predictable antibodyâantigen interactions to transiently deliver genome editing machinery selectively to cells of interest. Antibody-targeted Cas9-EDVs preferentially confer genome editing in cognate target cells over bystander cells in mixed populations, both ex vivo and in vivo. By using multiplexed targeting molecules to direct delivery to human Tâcells, Cas9-EDVs enable the generation of genome-edited chimeric antigen receptor Tâcells in humanized mice, establishing a programmable delivery modality with the potential for widespread therapeutic utility.
Subject terms: Protein delivery, Genetic vectors, Genetic engineering, Immunotherapy
Cell-specific molecular delivery with enveloped delivery vehicles enables genome editing ex vivo and in vivo.
Main
Therapeutic interventions involving genome editing require the safe and effective delivery of molecules into target cell nuclei1â3. Although such capability would transform both clinical and research applications, current non-viral delivery is limited to cells treated ex vivo4â6, tissues targeted by local administration7,8 or the liver because of its natural propensity for molecular uptake8,9. Recent lipid nanoparticle formulations have been described with tropism for non-hepatic cells or organs10,11, but expansion of in vivo genome editing applications will probably require multiple approaches for molecular delivery to specific cells or organs inside the body following systemic administration.
Retargeting the tropism of viruses or viral vectors is an established delivery strategy involving the surface display of a cell-selective targeting molecule alongside a viral glycoprotein required for cell entry by fusion at the plasma membrane or in the low-pH environment of the endosome12â15. Recent progress leverages a mutant form of the vesicular stomatitis virus glycoprotein (VSVG), VSVGmut, that maintains endosomal fusion activity but lacks native low-density lipoprotein receptor binding affinity16â18. Pairing VSVGmut with cell-specific targeting molecules can redirect lentiviral transgene delivery and has enabled high-throughput screening of Tâcell and Bâcell receptor libraries to study receptorâantigen interactions19,20.
Particles cloaked in cellular membrane fragmentsâsuch as retrovirus-like particles (VLPs), extracellular vesicles and biomimetic nanoparticlesâare gaining in popularity for the delivery of molecular cargo. For this class of EDVs, bioengineering is required to achieve molecular cargo packaging and control of targeting and fusogenic activity. Here, we show that human cell-specific genome editing can be achieved both ex vivo and in vivo by pairing the display of VSVGmut with antibody-derived single-chain variable fragments (scFvs) on EDVs that package Cas9 ribonucleoprotein (RNP) complexes (Cas9-EDVs). EDVs described in this paper leverage retroviral VLP assembly for the transient delivery of Cas9 RNPs8,21â27. We find that Cas9-EDVs achieve targeted genome editing within in vivo-generated chimeric antigen receptor (CAR) Tâcells in mice with a humanized immune system, with no off-target delivery to liver hepatocytes. These data show that EDVs are a programmable platform for delivering molecular cargo to specific cell types for complex genome engineeringâboth gene delivery and targeted gene disruptionâinside the body.
Results
Receptor-mediated delivery and genome editing with Cas9-EDVs
A major challenge for in vivo delivery of editing enzymes is the lack of vehicles capable of targeting specific cell types. VLPs can package Cas9 RNP complexes produced by over-expressing Cas9 fused to the carboxy-terminal end of the viral Gag polyprotein during VLP production, but cell-selective VLP targeting has relied on cell infection strategies evolved by enveloped viruses22. To test whether VLPs could be reformulated as programmable EDVs, we first cloned a CD19 targeting antibody as an scFv fused to the stalk and transmembrane domain of CD8a, a strategy commonly used in CAR architecture28 (Fig. 1a and Supplementary Fig. 1a,b). Given that Cas9-VLPs bud from the plasma membrane of transfected producer cells, we reasoned that co-expression of the scFv fusion and VSVGmut together with lentiviral components that are necessary for Cas9 RNP encapsulation would generate Cas9-EDVs possessing both receptor specificity and endosomal escape capability, respectively.
Fig. 1. Cell-specific genome editing with antibody-targeted Cas9-EDVs.
a, Schematic scFv targeting molecules (blue) and VSVGmut (orange) on the exterior surface of a Cas9-EDV. Cas9-EDVs package pre-formed Cas9-sgRNA complexes to avoid genetically encoding genome editors within a viral genome. b, Experimental outline and schematic of the lentiviral vector used for engineering HEK293T EGFP cells that express heterologous ligands on the plasma membrane (for example, CD19). To promote cellular engineering by single lentiviral integration events, engineered cell mixtures were generated through low multiplicity of infection to achieve <25% EGFP+ cells. Engineered cell mixtures were challenged with B2M-targeting Cas9-EDVs to test targeting molecule activity. câe, Assessment of antibody-targeted Cas9-EDV activity. HEK293T and CD19 EGFP HEK293T cells were mixed at an approximate ratio of 3:1 and treated with B2M-targeting Cas9-EDVs displaying various targeting molecule pseudotypes. Cas9-EDVs were concentrated 10à and cells were treated with 50âμl Cas9-EDVs (c,e) or in a dilution curve (d). Analysis was performed 7âdays post treatment to assess B2M knockout in EGFP+ (on-target) and EGFPâ (bystander) cells by flow cytometry (c,d) and amplicon sequencing (e). nâ=â3 technical replicates were used in all experiments except for the 100âμl dose of CD19-scFv in d (nâ=â2). Individual replicate values and four-parameter non-linear regression curves are plotted in d. Error bars in e, s.e.m.
To analyze the receptor-mediated function of Cas9-EDVs, we generated a HEK293T cell line that co-expresses both the Bâcell ligand CD19 and EGFP, enabling assessment of genome editing in on-target EGFP+ cells and off-target EGFPâ bystander cells (Fig. 1b). We produced Cas9-EDVs containing single guide RNA (sgRNA) targeting the β-2 microglobulin (B2M) gene and outwardly displaying either VSVG, CD19 scFv+VSVGmut or a control scFv+VSVGmut that should not recognize the target cells in this experiment. In an ~3:1 mixture of HEK293T and CD19 EGFP 293Tâcells, the VSVG Cas9-EDVs mediated genome editing in both CD19+ and CD19â populations, whereas the CD19-scFv Cas9-EDVs induced the knockout of B2M only in CD19+ cells (Fig. 1c). No B2M knockout was observed in either the CD19+ or CD19â cells using the control scFv+VSVGmut Cas9-EDVs. Antibody-targeted Cas9-EDV activity was titratable, with up to 74% of target cells exhibiting B2M knockout and little to no editing detected in bystander, non-target cells (Fig. 1d,e). Antibody-targeted Cas9-EDVs produced genome edits in target cells present at 2â92% of a cell mixture, whereas bystander cell editing was unchanged (Supplementary Fig. 1c). Together, these results demonstrate the ability of EDVs to deliver functional molecular cargo in a receptor-mediated fashion.
Programmable cell-specific genome editing with Cas9-EDVs
Receptor-mediated delivery of genome editing molecules could enable targeted engineering of any cell type as a function of its surface antigens. To test this possibility, we investigated the modularity and programmability of Cas9-EDVs to direct genome editing in HEK293T cells displaying various plasma membrane proteins normally expressed by human immune cells, including CD20, CD4 and CD28 (Fig. 1b and Supplementary Fig. 2a). Cas9-EDVs displaying VSVGmut and scFv-based CD20, CD4 and CD28 targeting molecules, generated in both variable heavy (VH)âlinkerâvariable light (VL) and VLâlinkerâVH orientations (Supplementary Table 1)29, induced up to 80% genome editing that was titratable and selective for ligand+ over ligandâ cells (Supplementary Fig. 2b). Not all scFvs produced the same level of on-target cell editing, but in no case was an scFv-displaying EDV able to induce more than minimal editing in off-target cells lacking the cognate surface receptor protein. Furthermore, in all engineered cell mixtures, ligand+ and ligandâ cells were similarly susceptible to genome editing when treated with control Cas9-EDVs that express the VSVG fusogen (Supplementary Fig. 2b). A panel of CD19, CD20 and CD4 antibody-targeted EDVs only mediated genome editing in cells expressing their matched ligand and not in mismatched ligand-expressing cells, demonstrating that delivery requires antibodyâantigen interactions (Supplementary Fig. 2c).
Cas9-EDV optimization and study of nonessential components
To enhance Cas9-EDV yield and per-particle editing efficiency ahead of in vivo administration, we screened multiple N-terminal nuclear localization signal (NLS) additions to Cas9 and found that 2Ã p53-derived NLS together with 3Ã nuclear export sequences (NESs) appended to the C-terminal end of Gag8 most improved the editing efficiency of antibody-targeted Cas9-EDVs (Supplementary Fig. 3aâd and Supplementary Table 2). Editing efficiency was further increased by expressing sgRNA from both the Gag-NES-NLS-Cas9 and Gag-pol plasmid backbones, as opposed to expression from a separate plasmid (Fig. 2a,b). We speculate that these optimizations improved Cas9 RNP loading into EDVs during assembly as well as enhanced Cas9 RNP nuclear import in target cells. Optimized Cas9-EDVs maintained receptor-mediated delivery specificity except at the highest doses tested (Supplementary Fig. 3e), and Cas9-EDV titration produced a 36-fold enrichment for genome editing on-target cells (79.7%) versus bystander cells (2.2%) (Supplementary Fig. 3f). Optimized Cas9-EDVs pseudotyped with the broadly transducing VSVG glycoprotein also demonstrated improved genome editing activity when tested on cytokine-stimulated primary human CD34+ cells and cytokine-stimulated and activated primary human Tâcells ex vivo (Fig. 2c,d). Surprisingly, optimized VSVG-pseudotyped Cas9-EDVs mediated genome editing in resting primary human Tâcells (Fig. 2e), which are difficult to edit using standard electroporation approaches. This suggests that Cas9-EDVs may be an effective strategy for genome editing Tâcells in the absence of cellular activation, stimulation and expansion.
Fig. 2. Optimization of Cas9-EDVs for enhanced genome editing activity in primary human cells.
a, Genome editing activity comparison of CD19 antibody-targeted Cas9-EDV variants packaging B2M-targeted Cas9 RNPs. Expression of B2M protein was assessed by flow cytometry 7âdays post treatment in CD19-expressing target cells. b, Diagram of the optimized Gag-Cas9 and Gag-pol Cas9-EDV production plasmids; features updated from a previous study22 are highlighted in teal. câe, Genome editing activity of optimized VSVG-pseudotyped Cas9-EDVs in primary human CD34+ cells (c) and activated (d) and resting primary human Tâcells (e). B2M or TRAC genome editing was assessed by amplicon sequencing 7âdays post treatment; nâ=â3 technical replicates were assessed for all conditions except for the untreated resting human Tâcells (nâ=â2). f, Schematic of potential intra-particle Cas9-EDV configurations for packaged Cas9 RNPs following proteolytic maturation. g, Schematic of the compound GS-CA1 inhibiting either the nuclear import and/or uncoating of an HIV-1 capsid. h, An mNeonGreen lentiviral vector was used to transduce HEK293T cells at the indicated multiplicity of infection (MOI) in the presence of GS-CA1 or DMSO. The percent of mNeonGreen-positive cells was assessed by flow cytometry 3âdays post treatment. TU, transducing units. i, B2M-targeting Cas9-EDVs, pre-titered such that the highest treatment dose would result in approximately 50% of cells B2Mâ, were used to transduce HEK293T cells in the presence of GS-CA1 or DMSO. B2M expression was assessed by flow cytometry 3âdays post treatment. Error bars, s.e.m. Unless otherwise noted, nâ=â3 technical replicates were used in all experiments; four-parameter non-linear regression curves are plotted in a, h and i.
We next investigated whether the internal composition of Cas9-EDVs affects editing efficiency, focusing on the lentiviral capsid that forms during proteolytic virion maturation30 (Fig. 2f). To probe the role of the capsid in Cas9-EDV delivery, we employed GS-CA1, a small-molecule inhibitor of nuclear import and/or subsequent uncoating of HIV-1 capsid cores31,32 (Fig. 2g). Treatment of target cells with increasing concentrations of GS-CA1 blocked the integration of a lentiviral transgene, which relies on nuclear import from the capsid (Fig. 2h), but did not negatively impact the genome editing efficiency of Cas9-EDVs (Fig. 2i) or electroporated Cas9 RNPs (Supplementary Fig. 3g). In a separate experiment, we generated a Cas9-EDV variant that relies on the tobacco etch virus (TEV) protease to release Cas9 from Gag (âTEVp-Cas9-EDVsâ; Supplementary Fig. 3h), preventing the HIV-1 protease-dependent virion maturation required for capsid assembly. Despite the demonstrated loss of Gag proteolytic processing (Supplementary Fig. 3i), TEVp-Cas9-EDVs maintained genome editing activity in treated cells proportional to the amount of Cas9 generated (Supplementary Fig. 3j). These results suggest that the capsid is not required for packaging and delivering Cas9 RNP complexes into target cell nuclei.
Optimized Cas9-EDV characterization
We next performed characterization of Cas9-EDVs to better understand particle composition and genome editing activity. Cas9-EDVs are similar in diameter to lentiviral vectors (LVs) (Supplementary Fig. 4a,b), and multiple scFvs are detectable on the surface of antibody-targeted particles (Supplementary Fig. 4c). Interestingly, we could detect Cas9-independent packaging of over-expressed sgRNA into Cre recombinase-packaging Cas9-EDVs, but sgRNA packaging was enhanced ~330-fold in Cas9-containing particles (Supplementary Fig. 4d). While others have shown the unintended packaging of cellular RNAs and proteins into retroviral vectors23,33, which probably occurs in Cas9-EDVs, we could not detect unintended Cas9-EDV-mediated delivery of plasmids from producer cells to treated cells (Supplementary Fig. 4e,f).
Using synthetic sgRNA as a standard curve (Supplementary Fig. 4g), we estimate that Cas9-EDVs produced in one 10âcm plate contain ~2.66âÃâ1011 sgRNA molecules (Supplementary Fig. 4g) distributed among approximately 5.65âÃâ1010 Cas9-EDV particles (Supplementary Fig. 4i). Benchmarking Cas9-EDVs against Cas9 RNP nucleofection, we found that treatment with 0.2âμl of 30-fold concentrated Cas9-EDVs resulted in the equivalent amount of genome editing as ~23âpmol of nucleofected RNP (Supplementary Fig. 4jâl). Finally, we tested the biodistribution of wild-type VSVG versus VSVGmut pseudotyped LVs and found that relative to the amount of vector in the serum, both pseudotypes exhibited similar biodistribution patterns shortly after systemic administration, suggesting that VSVGmut display does not hinder in vivo particle trafficking (Supplementary Fig. 4m).
Multiplexed targeting molecules for human Tâcell engineering
Human Tâcells are important targets for in vivo genome engineering applications because of their use in treating cancer and other diseases. Using CD25 expression as a marker, we found that the co-display of CD3 and CD28 targeting molecules on Cas9-EDVs triggered Tâcell activation and cellular expansion similar to Tâcells pretreated with commercially available CD3 or CD28 coated magnetic beads34 or engineered lentiviruses19 (Fig. 3a,b). CD3â+âCD28 scFv Cas9-EDV treatment also led to robust levels of genome editing (Fig. 3c).
Fig. 3. Multiplexed antibody targeting and editing of primary human T cells.
a,b, Treating resting human Tâcells with Cas9-EDVs co-displaying CD3 and CD28 scFvs results in cellular activation (a) and proliferation (b) as measured by flow cytometry detection of CD25 3âdays post treatment and fold expansion relative to the untreated Tâcell count, respectively. CD25 expression and cellular proliferation was observed for CD3/CD28 scFv Cas9-EDVs, regardless of whether they packaged Cas9 RNPs targeting PDCD1 or a non-targeting control. c, Genome editing 3âdays post treatment, as detected by amplicon next-generation sequencing. For aâc, Cas9-EDVs were concentrated 62à and 50âμl was used to treat 30,000 resting Tâcells. CD3 scFv-1 and CD28 scFv-2 were tested. d, Screening the mono-display of additional CD3 scFv targeting molecules for B2M-targeted Cas9-EDVs on the Jurkat Tâcell line. B2M expression was assessed by flow cytometry 3âdays post treatment. Cas9-EDVs were concentrated 15à and 50âμl was used to treat 30,000 Jurkat cells. e, Testing a panel of Tâcell-targeted, B2M-targeting Cas9-EDVs, displaying single or multiplexed scFv targeting molecules. Activated primary human Tâcells were treated with 1.38âÃâ108 Cas9-EDVs, displaying one or a combination of CD3 scFv-3, CD4 scFv-2, CD28 scFv-2 and a control scFv, and were assessed for B2M expression in CD4+ and CD8+ Tâcells by flow cytometry 6âdays post treatment. Error bars, s.e.m.; nâ=â3 technical replicates were used in all experiments.
Further screening of CD3 and CD45 scFvs revealed additional Cas9-EDV targeting molecules that enabled genome editing of the human Jurkat Tâcell line (Fig. 3d and Supplementary Fig. 5a). The minimal human Tâcell editing observed with CD45-targeted Cas9-EDVs may result from a lack of CD45 internalization from the plasma membrane following monoclonal antibody engagement35 (Supplementary Fig. 5b,c). Primary human Tâcells were susceptible to genome editing using CD3-targeted Cas9-EDVs and, to a lesser extent, CD4-targeted Cas9-EDVs, but not Cas9-EDVs pseudotyped with off-target control scFv targeting molecules (Fig. 3e and Supplementary Fig. 5d). Immunophenotyping of Tâcells post Cas9-EDV treatment showed that CD3-targeted Cas9-EDVs direct genome editing in CD4+ and CD8+ subsets of Tâcells as expected, whereas CD4 scFv-targeted Cas9-EDVs specifically mediated genome editing in the CD4+ subset population (Fig. 3e and Supplementary Fig. 5d). Interestingly, multiplexing CD3 and CD4 scFv targeting molecules on the same Cas9-EDVs led to higher levels of editing than Cas9-EDVs displaying either CD3 or CD4 scFv targeting molecules alone (Fig. 3e and Supplementary Fig. 5d). This observation was antigen-specific, as multiplexing CD3 targeting molecules with off-target control targeting molecules did not enhance genome editing. Receptor cross-linking or aggregation can lead to endocytosis and subsequent lysosomal degradation36,37, possibly explaining the synergistic increase in genome editing by engaging both CD3 and CD4 receptors.
Tâcell targeted Cas9-EDVs enable genome engineering in vivo
Antibody-targeted EDVs have the unique flexibility of enabling cell-specific delivery of either genome editors alone, lentiviral-encoded transgenes alone or genome editors and transgenes together. We next investigated the ability of antibody-targeted EDVs to perform cell-targeted engineering of human CAR Tâcells in vivo, an advance that could negate the delays and costs associated with ex vivo CAR T manufacturing38,39. Using immunodeficient mice engrafted with human peripheral blood mononuclear cells (PBMCs) to mimic a humanized immune system, we tested Tâcell-targeted vectors for their ability to generate either CAR Tâcells (LV) or gene-edited CAR Tâcells (Cas9-EDV vector) in vivo (Fig. 4a). Both vectors package a lentiviral-encoded α-CD19-4-1BBz CAR-P2A-mCherry transgene, with the Cas9-EDVs additionally co-delivering Cas9 RNP complexes to disrupt the Tâcell receptor alpha constant (TRAC) gene. Both vectors rely on semi-random integration of the transgene for CAR expression and both co-display CD3, CD4 and CD28 scFvs to trigger enhanced cell entry (CD4â+âCD3) as well as cell activation and proliferation (CD3â+âCD28).
Fig. 4. Programmable human cell delivery generates gene-edited CAR T cells in vivo.
a, Summary of Tâcell-targeted Cas9-EDVs and lentivirus tested in PBMC-humanized mice. Both particles display multiplexed scFvs (CD3 scFv-3, CD4 scFv-1 and CD28 scFv-2). The Cas9-EDV vector co-packages a lentiviral-encoded CAR-2A-mCherry transgene and Cas9 RNP complexes to disrupt the TRAC gene; the lentivirus encodes the CAR-2A-mCherry transgene. b, Experimental schematic for testing Tâcell-targeted Cas9-EDVs and lentivirus in PBMC-humanized mice by intravenous (I.V.) retro-orbital injections. c, Representative flow cytometry plots demonstrating that CAR-expressing human Tâcells are detectable in the spleens of PBMC-humanized mice 10âdays post administration of 1.5âÃâ109 Cas9-EDV (nâ=â2 animals) or lentivirus (nâ=â3 animals) but not in mice administered PBS (nâ=â3), quantified in d. e,f, Gene editing is observed in CARâ and CAR+ human Tâcells isolated from mice treated with Tâcell-targeted Cas9-EDVs (nâ=â2 animals) and Tâcell-targeted lentivirus (nâ=â3 animals). One CAR+ lentivirus sample was excluded in f because of failing sequencing. g, CAR-expressing human Tâcells are detectable in the spleens of PBMC-humanized mice 10âdays post administration of 6.2âÃâ108 Cas9-EDV (nâ=â8 animals) or lentivirus (nâ=â8 animals) but not in mice administered PBS (nâ=â4 animals). Pâvalues calculated by means of Dunnettâs multiple comparison test after BrownâForsythe and Welsh one-way ANOVA. h,i, Genome editing is observed in CARâ and CAR+ human Tâcells isolated from mice treated with Tâcell-targeted Cas9-EDVs (nâ=â8 animals per group). Significance calculated by two-sided unpaired t-test. Comparison in i is not significant (Pâ>â0.05). For all plots, black lines indicate the median of the data set. LOD, limit of detection as defined by the average modified reads from lentiviral-treated samples.
Tâcell-targeting Cas9-EDVs containing the CAR transgene (nâ=â4) or Tâcell-targeting lentivirus containing the CAR transgene (nâ=â3) were systemically administered and in vivo cell engineering was assessed 10 days post treatment (Fig. 4b). CAR-transduced Tâcells were observed in all mice in which human cells successfully engrafted, as detected by mCherry expression (Fig. 4c,d and Supplementary Fig. 6aâc). In the two Cas9-EDV-treated mice that successfully engrafted with human Tâcells (nâ=â2 out of 4), we observed 1.67% and 1.51% modified alleles in the CAR-transduced Tâcells, compared to 0.04% and 0.04% in the CARâ Tâcells isolated from the same mice (Fig. 4e,f). As expected, no modified alleles were observed in cells isolated from mice treated with the Tâcell-targeted lentivirus. We repeated this experiment with mice humanized with PBMCs from a different donor and with more mice per treatment group, and we again observed CAR Tâcells generated in vivo in eight out of eight mice treated with Tâcell-targeted Cas9-EDVs and eight out of eight mice treated with Tâcell-targeted lentivirus (~0.5% vs ~5% CAR+â Tâcells, respectively) (Fig. 4g and Supplementary Fig. 6dâf). Again, we observed genome editing only in mice (nâ=â4 out of 8) treated with Cas9-EDVs, with higher levels of genome editing in CAR-transduced Tâcells than in CARâ Tâcells (Fig. 4h, i). Treatment with the Tâcell-targeted Cas9-EDV and lentivirus was well tolerated, with no weight loss observed (Supplementary Fig. 6g). Although mCherry+ F4/80+ Kupffer cells/macrophages were observed, no mCherry+ β-catenin-expressing hepatocytes were detected in the liver (Supplementary Fig. 7aâd). Together, these results indicate that antibody-based targeting of Cas9-EDVs is a strategy that maintains cell-selective and tissue-specific delivery of transgenes and genome editors in vivo.
The primary objective of our humanized mouse experiments was to assess Cas9-EDVs for their ability to mediate cell-targeted genome editing and transgene delivery in vivo. Given that human CD19+ Bâcells, in addition to Tâcells, engrafted in the second mouse cohort, we additionally assessed in vivo CAR Tâcell killing activity. Variable levels of CD19+ Bâcells were observed in Cas9-EDV-treated mice, and no CD19+ Bâcells were detected in mice treated with antibody-targeted lentivirus, demonstrating in vivo CAR Tâcell-mediated cytotoxicity (Fig. 5a and Supplementary Fig. 8a). This analysis suggests a model in which antibody-derived targeting molecules can direct molecular cargo to specific cells in vivo to successfully reprogram cell activity (Fig. 5b). Diverse Tâcell clonotypes were observed for CAR-transduced Tâcells isolated from mice in both groups (Fig. 5c), suggesting that multiple cells were engineered in vivo and did not arise solely through expansion of a single engineered cell. Given that clonotype diversity correlated with the number of CAR Tâcells analyzed (Supplementary Fig. 8b), the clearance of Bâcells in the lentiviral group was probably attributable to a higher number of CAR Tâcells generated during the initial in vivo transduction. Taken together, these findings offer an approach for generating genome-engineered cells with complex edits that could prove valuable for a wide range of clinical applications in the future.
Fig. 5. Functional dynamics of cellular engineering in vivo.
a, Depletion of CD19+ Bâcells is observed post administration of Tâcell-targeted lentivirus (experiment 2). Human CD45+ cells were isolated from PBMC-humanized spleens 10âdays post systemic administration of Tâcell-targeted Cas9-EDV (nâ=â8 animals), lentivirus (nâ=â8 animals) or PBS (nâ=â4 animals), and the percentage of CD19-expressing cells was assessed by flow cytometry. Pâvalues calculated by means of Dunnettâs multiple comparison test after ordinary one-way ANOVA. **Pâ<â0.01. Black lines indicate the median of the data set. b, Model for the in vivo generation of CAR Tâcells, with or without simultaneous genome editing. Schematic made with Biorender and is not to scale. c, Tâcell receptor clonotypes of CAR-transduced Tâcells isolated from humanized mice treated with Tâcell-targeted Cas9-EDV (mouse numbers 2, 4, 6) or lentivirus (mouse numbers 13, 14, 17) from experiment 2. ânâ indicates the unique number of clonotypes detected.
Discussion
The EDVs created here combine the molecular packaging and cellular transduction capabilities of a lentivirus with the cell-surface recognition properties of antibodies to deliver Cas9 protein, sgRNAs and transgenes into specific human cell types, both ex vivo and in vivo. Co-display of scFv antibody fragments and the VSVGmut fusogen on the Cas9-EDV envelope provides selectivity of cell transduction. Antibody-directed Cas9-EDVs mediate genome editing in targeted human cells over bystander, non-target cells in vitro and in humanized mice without transducing hepatocytes, thus avoiding a common barrier to selective in vivo delivery owing to passive liver uptake.
Cas9-EDVs enable complex cell engineering in specific cells, as shown by in vivo generation of gene-edited human CAR Tâcells, with important advantages relative to other in vivo delivery methods. First, unlike VLP-mediated delivery8, EDVs can be administered systemically for cell-type specific receptor-mediated delivery of multiple cargo molecules, including protein, RNA and DNA. Second, in contrast to viral vector-based methods for delivering DNA-encoded molecules40â42, EDVs provide transient delivery of preassembled genome editors whose short lifetime limits off-target editing. In addition, both adeno-associated virus and lentiviral delivery can involve random transgene integration43,44 that could be avoided in the future using Cas9 RNP-mediated genome editing for targeted transgene knock-in. Third, distinct from reported viral vectors45 and lipid nanoparticles40, antibody-targeted EDVs do not induce detectable transduction of liver hepatocytes, which could help avoid toxicity by minimizing the effective concentration necessary for therapeutic benefit. Finally, in contrast to previous in vivo CAR Tâcell generation reports using retargeted retroviruses46,47, there is no need for Tâcell activation before vector administration because Cas9-EDVs activate Tâcells during delivery. No treatment-related toxicity was observed following Tâcell-targeted vector administration in vivo; however, it will be important for future studies to assess the impact of vector dose on triggering aberrant Tâcell activation and proliferation.
Clonotype analysis of in-vivo-generated CAR Tâcells indicated that multiple independent transduction events occurred in vivo. The incomplete Bâcell aplasia observed for the Tâcell-targeted Cas9-EDV dose tested here is probably explained by the number of Cas9-EDV-generated CAR Tâcells being below a threshold needed for Bâcell ablation in the first 10âdays post systemic administration. At ten days post systemic administration, we observed that 5% of all Tâcells were CAR+ in mice that were administered the Tâcell-targeted lentivirus compared to 0.5% in mice administered the Tâcell-targeted Cas9-EDV. Although this does not tell us about initial in vivo transduction rates, which could be occluded because of CAR Tâcell expansion, it does suggest that 5% CAR Tâcells at 10âdays correlates with Bâcell aplasia in this humanized mouse model. Future experiments will assess Bâcell ablation either at later time points post Cas9-EDV administration to allow more time for cellular expansion or test higher doses of Cas9-EDVs to generate more CAR Tâcells initially. To test higher doses, future work will investigate methods for boosting the yield of antibody-targeted Cas9-EDVs, as the current process is less effective than VSVG-pseudotyped Cas9-EDV production. Additionally, it is likely that the packaging of Cas9 RNPs alongside a transgene inhibits successful gene transduction by Cas9-EDVs. Future work will also focus on optimizing the co-delivery of Cas9 RNP complexes and transgenes to improve the efficiency of Cas9-EDV gene delivery in vivo.
Two aspects of Cas9-EDV composition and cell targeting efficiency were unexpected and warrant further analysis. First, the capsid is not needed and potentially inhibits Cas9-mediated genome editing, showing that EDV-delivered Cas9 RNP complexes with nuclear localization tags are sufficient to promote nuclear access. Limiting viral structural components to those essential for EDV production may improve the per-particle delivery efficiency of Cas9-EDVs. Second, the finding that not all scFv-based targeting molecules result in equivalent levels of genome editing in target cells suggests that productive EDV delivery requires more than antigen binding. For example, CD45 does not undergo internalization upon antibody binding, which may explain the minimal editing achieved by CD45-scFv Cas9-EDVs (refs. 35,48). In addition, differences in scFv delivery may result from suboptimal targeting molecule display on Cas9-EDVs.
The results reported here merge the single-treatment potential of genome engineering with cell-specific delivery of preassembled genome editors to provide an approach to selective cell editing ex vivo and in vivo. Although this report focuses on the engineering of human immune cells (Tâcells), future work will be extended to non-immune cells, with a particular focus on the targeted engineering of tissue-resident stem cells in vivo. These findings also shed light on fundamental aspects of fusion-based cargo delivery that may be further uncovered through the investigation of EDV-based molecular trafficking, offering the potential to use EDVs for fundamental research as well as therapeutic delivery applications.
Methods
Plasmid construction
VSVGmut (K47A R354A VSVG) sequence was human codon-optimized and synthesized as a gBlock (Integrated DNA Technologies, IDT) and then cloned into the pCAGGS expression plasmid. To generate the CD19 scFv-1 expression plasmid, the sequence encoding the CD8a signal peptide, myc epitope tag, scFv and CD8a stalk and transmembrane domain of a-CD19-4-1BBζ-P2A-mCherry22,49,50 was subcloned into pCAGGS. This plasmid was subsequently used as an entry plasmid for cloning all other scFv antibody fragments; the CD8a signal peptide, myc tag and scFv sequences were dropped out by EcoRI/Esp3I restriction digest (New England Biolabs, NEB) and new DNA sequences encoding CD8a signal peptide and scFv were inserted. This cloning strategy resulted in removing the N-terminal myc epitope tag and adding a serine amino acid residue between the scFv and CD8a hinge domains. A flexible linker (GGGGSGGGGSGGGGSS) was used to link VH and VL domains of source monoclonal antibody sequences. If the antibody source sequence was already an scFv, then the linker from the source sequence was used. Except for CD19 scFv-1, all antibody fragment sequences were human codon-optimized and synthesized as eBlock Gene Fragments (IDT). Lastly, a CD19 scFv expression plasmid with 2à strep-tag was generated by removing the myc tag from CD19 scFv-1 and inserting the 2à strep-tag. InFusion cloning (Takara Bio) was used to generate all plasmids. Additional information on the scFv targeting molecules and sequence sources can be found in Supplementary Table 1.
A second-generation lentiviral transfer plasmid encoding expression of EF1a promoter, CAR-P2A-mCherry22, was digested with XbaI and MluI (NEB) to drop out the CAR-P2A-mCherry transgene. Human CD19 (Uniprot no. Q71UW0) DNA was ordered as a gBlock (IDT) and IRES-EGFP (amplified from the Xlone TRE3G MCS-TEV-Halo-3XF IRES EGFP-Nuc-Puro plasmid, a gift from the Darzacq/Tijan Lab) sequences were inserted using InFusion cloning (Takara Bio). This cloning strategy inserted a MluI restriction digest site 3â² of the CD19 stop codon and removed the MluI restriction digest site 3â² of the EGFP stop codon. Human CD4 (Uniprot no. P01730), CD20 (Uniprot no. P11836) and CD28 (Uniprot no. P10747) amino acid sequences were human codon-optimized for synthesis and ordered as an eBlock (CD28) or gBlocks (CD20, CD4) (IDT). Ligand-encoding sequences were cloned by restriction digest removal of CD19-encoding sequence from the EF1a-CD19 IRES-EGFP lentiviral plasmid using XbaI and MluI (NEB), and inserted with InFusion cloning (Takara Bio). VSVGmut and scFv targeting plasmids were prepared using the HiSpeed Plasmid Maxi or Plasmid Plus Midi kits (Qiagen). Lentiviral plasmids were prepared with the QIAprep Spin Miniprep Kit (Qiagen). All plasmids were sequence-confirmed (UC Berkeley DNA Sequencing Facility, Quintara Bio or Primordium Labs) before use.
All Gag-fusion constructs were cloned using InFusion cloning (Takara Bio). The p53-NLS amino acid 305â322 sequence was obtained by reverse transcription PCR (RTâPCR) using RNA extracted from Raji cells as a template with the SuperScript III One-Step RTâPCR System with Platinum Taq DNA Polymerase (Thermo Fisher). The 2Ã p53-NLS was constructed by linking two p53 NLS sequences by a flexible linker (GGSGG); the 2Ã p53-NLS sequence was then inserted into Gag-Cas9 (Addgene plasmid no. 171060) with InFusion cloning (Takara Bio). Gag-Cas9 and Gag-(2Ã p53-NLS)-Cas9 were digested with MfeI-HF and AgeI-HF (NEB). The 3Ã NES sequence was human codon-optimized, synthesized as a gBlock (IDT) and inserted with InFusion cloning (Takara Bio) to generate Gag-(3Ã NES)-(2Ã p53-NLS)-Cas9.
The U6-sgRNA expression cassette was cloned into the plasmid backbones of Gag-(3Ã NES)-(2Ã p53-NLS)-Cas9 and psPax2 as follows: Gag-(3Ã NES)-(2Ã p53-NLS)-Cas9 was digested with SalI-HF (NEB). The Gag-pol expression plasmid psPax2 (Addgene plasmid no. 12260) was first digested with AflII and SacI (NEB) to remove a SalI restriction site. The modified psPax2 was then digested with SalI-HF (NEB). The U6-sgRNA expression cassette was amplified from the spyCas9 sgRNA-BsmBI-Destination plasmid (Addgene plasmid no. 171625) and inserted into the digested Gag-(3Ã NES)-(2Ã p53-NLS)-Cas9 and psPax2 with InFusion cloning (Takara Bio). Oligos encoding sgRNA spacers (B2M, 5â²-GAGTAGCGCGAGCACAGCTA; TRAC, 5â²-AGAGTCTCTCAGCTGGTACA; PDCD1, 5â²-CGACTGGCCAGGGCGCCTGT; tdTomato, 5â²-AAGTAAAACCTCTACAAATG; control, 5â²-GTATTACTGATATTGGTGGG) were ordered from IDT, phosphorylated, annealed and ligated into BsmBI-digested sgRNA expression vectors.
The U6-B2M Gag-(3Ã NES)-(2Ã p53-NLS)-Cre plasmid was generated as follows: Gag-Cre was digested with MfeI-HF and NheI. The (3Ã NES)-(2Ã p53-NLS)-Cre sequence was synthesized as a gBlock (IDT) and inserted downstream of Gag with InFusion cloning (Takara Bio). Then, the Gag-(3Ã NES)-(2Ã p53-NLS)-Cre plasmid was digested with XbaI and PvuI-HF (NEB). The U6-B2M expression cassette was isolated by digesting U6-B2M Gag-(3Ã NES)-(2Ã p53-NLS)-Cas9 with XbaI and PvuI-HF (NEB) and inserted into the digested Gag-(3Ã NES)-(2Ã p53-NLS)-Cre with T4 DNA ligase (NEB).
Sequences for EDV production plasmids are in Supplementary Table 2.
Tissue culture and cell line generation
Lenti-X and HEK293T cells, obtained and authenticated by the UC Berkeley Cell Culture Facility, were cultured in DMEM (Corning) supplemented with 10% fetal bovine serum (VWR) and 100 U mlâ1 penicillin-streptomycin (Gibco) (cDMEM). To generate lentiviruses encoding EF1a-ligand IRES-EGFP, 3.5â4 million Lenti-X cells were plated in a 10âcm tissue culture dish (Corning) and transfected with 1âµg pCMV-VSV-G (Addgene plasmid no. 8454), 10âµg psPax2 (Addgene plasmid no. 12260), and 10âµg of EF1a-ligand IRES-EGFP lentiviral transfer plasmid using polyethylenimine (Polysciences) at a 3:1 PEI:plasmid ratio. Lentiviral-containing supernatants were collected 2âdays post transfection and passed through a 0.45âµm PES syringe filter (VWR). Ligand-expressing cells were generated by transducing HEK293T cells (100,000 per well in a 12-well dish) with lentivirus (0.15â1âml) in a total well volume of 1âml. Four days post transduction, flow cytometry was used to identify cell mixtures in which <25% of cells were expressing EGFP. Following expansion, CD19 EGFP HEK293T cells were additionally sorted for EGFP expression using an SH800S cell sorter (Sony Biotechnology) to generate a population of ~100% CD19+EGFP+ cells.
Tâcell culture
Cryopreserved PBMCs (AllCells) were thawed in X-VIVO 15 (Lonza) with 50âµM 2-mercaptoethanol (Gibco), 5% fetal bovine serum (VWR) and 10âmM N-acetyl l-cysteine (Sigma-Aldrich). This media was also used to culture the Tâcells isolated from PBMCs. To isolate Tâcells, PBMCs were incubated in 100âµgâmlâ1 DNase I solution (StemCell Technologies) at room temperature (22â°C) for 15âmin and resuspended in EasySep Buffer (StemCell Technologies). Aggregated suspensions were filtered through a 37âµm cell strainer (StemCell Technologies) and incubated with EasySep Human TâCell Isolation Cocktail (StemCell Technologies). Then, EasySep Dextran RapidSpheres (StemCell Technologies) were used to separate Tâcells via an EasySep Magnet (StemCell Technologies). Dynabeads Human T-Activator CD3/CD28 (Gibco) and recombinant human 500âUâmlâ1 IL-2 (Peprotech), 5ângâmlâ1 IL-7 (Peprotech) and 5ângâmlâ1 IL-15 (R&D Systems) were used to stimulate and activate Tâcells for 2âdays before treatment. Pre-activated Tâcells were cultured in media containing 500âUâmlâ1 IL-2 (Peprotech).
CD34+ cell culture
Cryopreserved G-CSF-mobilized human CD34+ cells were acquired from AllCells. Cells were thawed, resuspended in IMDM (Gibco), spun and then cultured in StemSpan SFEM II media (StemCell Technologies) with 100âUâmlâ1 penicillin-streptomycin (Gibco) and the cytokine cocktail StemSpan CC110 (StemCell Technologies). Cells were treated with 8âµM cyclosporine H (Sigma-Aldrich) for 24âh before treatment. Additionally, cells were treated with 1âµgâmlâ1 poloxamer (BASF) at the time of treatment. Cas9-EDVs were concentrated 50-fold using Lenti-X Concentrator (Takara Bio), resuspended in SFEM II media and mixed with 40,000 CD34+ cells in a final well volume of 100âµl. Transduction was performed in a U-bottom 96-well plate for 24âh on an orbital shaker before cells were spun, expanded 1:1 and cultured stationary until analysis.
Cas9-EDV production
Cas9-EDVs (formerly known as âCas9-VLPsâ) were produced as previously described22. In brief, VSVG-pseudotyped Cas9-EDVs were produced by seeding 3.5â4 million Lenti-X cells (Takara Bio) into 10âcm tissue culture dishes (Corning) and transfecting the next day with 1âµg pCMV-VSV-G (Addgene plasmid no. 8454), 6.7âµg Gag-Cas9 (Addgene plasmid no. 171060), 3.3âµg psPax2 (Addgene plasmid no. 12260) and 10âµg U6-sgRNA (Addgene plasmid no. 171635 or Addgene plasmid no. 171634) using polyethylenimine (Polysciences) at a 3:1 PEI:plasmid ratio. Antibody-targeted Cas9-EDVs were produced in the same way as VSVG Cas9-EDVs, except that the pCMV-VSV-G plasmid was omitted and 7.5âµg of scFv targeting plasmid and 2.5âµg of VSVGmut were included during transfection. For scFv multiplexing, a total of 7.5âµg scFv plasmids was used, split 1:1 or 1:1:1 unless otherwise described in the figure legend. For Cas9-EDVs used to treat primary human cells (Tâcells, CD34+ cells) or humanized mice, media was changed 6â18âh post transfection into Opti-MEM (Gibco). Two days post transfection (or media change), Cas9-EDV-containing supernatants were collected, passed through a 0.45âµm PES syringe filter (VWR) and concentrated with Lenti-X Concentrator (Takara Bio) according to the manufacturerâs instructions. Concentrated Cas9-EDVs were resuspended in Opti-MEM (Gibco) at a final concentration of 10à unless otherwise noted in the figure legend. Cas9-EDVs were stored at 4â°C or frozen at â80â°C within an isopropanol-filled freezing container until use.
To optimize Cas9-EDVs, variants with different Gag-Cas9 polypeptides were produced in the same way as described above, except that 6.7âµg of each Gag-Cas9 variant (Gag-(3à NES)-Cas9, Gag-(2à p53-NLS)-Cas9 and Gag-(3à NES)-(2à p53-NLS)-Cas9) was used instead of Gag-Cas9 during transfection. Gag-(3à NES)-(2à p53-NLS)-Cas9 EDVs with U6-sgRNA expression from plasmid backbones were produced similarly, except that the U6-B2M plasmid was omitted, and 6.7âµg of U6-sgRNA Gag-(3à NES)-(2à p53-NLS)-Cas9 and 3.3âµg of U6-sgRNA psPax2 were included instead of the Gag-Cas9 and psPax2 plasmids during transfection. To capture both improvements in Cas9-EDV particle production and the per-particle editing efficiency of Cas9-EDVs, we produced equivalent numbers of transfected 10âcm tissue culture dishes (Corning) of each Cas9-EDV variant tested.
For humanized mouse experiments, Cas9-EDVs were produced by transfecting Lenti-X cells with 2.5âµg of each scFv targeting plasmid (CD3 scFv-3, CD4 scFv-1 and CD28 scFv-2), 2.5âµg of VSVGmut, 3.3âµg of U6-TRAC Gag-(3à NES)-(2à p53-NLS)-Cas9, 6.7âµg of U6-TRAC psPax2 and 2.5âµg of the lentiviral transfer plasmid encoding an α-CD19-4-1BBz CAR-P2A-mCherry transgene, as optimized in a previous study22. Lentivirus was produced in the same way, except that U6-TRAC Gag-(3à NES)-(2à p53-NLS)-Cas9 and U6-TRAC psPax2 were omitted and 10âµg psPax2 was included. Cas9-EDV-containing and LV-containing supernatants were passed through a 0.45âµm PES filter bottle (Thermo Fisher) and concentrated through ultracentrifugation by floating the supernatant on top of a cushioning buffer of 30% (w/v) sucrose in 100âmM NaCl, 10âmM Tris-HCl pH 7.5, 1âmM EDTA pH 8.0, at 85,000Ãg with a SW28 Ti rotor (Beckman Coulter) for 2âh at 4â°C in polypropylene tubes (Beckman Coulter). After ultracentrifugation, the Cas9-EDV pellet was resuspended in sterile Dulbeccoâs phosphate-buffered saline (DPBS) (Gibco).
Cas9 RNP electroporation
B2M-targeting crRNA (IDT) and tracrRNA (IDT, no. 1072534) were resuspended in IDT duplex buffer to 160âµM, combined at a ratio of 1:1 and annealed at 37â°C for 30âmin. Cas9 RNPs were formed by combining the annealed crRNA and tracrRNA and 40âµM Cas9-NLS (UC Berkeley QB3 MacroLab) at a molar ratio of 2:1 and incubating at 37â°C for 15âmin. Electroporation was performed using a 96-well format 4D-nucleofector (Lonza) with 200,000 cells per well. HEK293T cells were electroporated with the SF buffer and the CM-130 pulse code, and primary human Tâcells were electroporated with the P3 buffer and the EH-115 pulse code. Cells were immediately resuspended in pre-warmed media, incubated for 20âmin and transferred to culture plates.
Cas9-EDV titer quantification
The QuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24) (Cell Biolabs) was used to quantify Cas9-EDV particle number. Cas9-EDVs were diluted 1:1,00â100,000, and ELISA was performed according to the manufacturerâs directions. Absorbance at 450ânm was measured by a plate reader (BioTek). Cas9-EDV p24 content was calculated by comparison to serial dilution of a p24 standard, and guidance from the manufacturer was used to convert p24 quantity into particle number (Cell Biolabs).
Western blot analysis
Cas9-EDVs were mixed with Laemmli buffer containing 10% 2-mercaptoethanol and heating at 90â°C for 5âmin. Proteins from whole cell lysates were separated by 4%â20% SDSâPAGE gel (Bio-Rad) and transferred to an Immun-Blot low fluorescence PVDF membrane (Bio-Rad). Membranes were blocked and incubated with primary antibodies at 4â°C overnight followed by secondary antibodies at room temperature for 1âh. Primary and secondary antibodies are listed in Supplementary Table 3. Imaging was performed using the Odyssey imaging system (LI-COR).
GS-CA1 experiments
To generate lentiviruses encoding EF1a-mNeonGreen, 3.5â4 million Lenti-X cells were plated in a 10âcm tissue culture dish (Corning) and transfected with 1âµg pCMV-VSV-G (Addgene plasmid no. 8454), 10âµg psPax2 (Addgene plasmid no. 12260) and 2.5âµg of EF1a-mNeonGreen lentiviral transfer plasmid using polyethylenimine (Polysciences) at a 3:1 PEI:plasmid ratio. Lentiviral-containing supernatants were collected 2âdays post transfection and passed through a 0.45âµm PES syringe filter (VWR). Lentiviral supernatants were concentrated 20à with Lenti-X Concentrator (Takara Bio) according to the manufacturerâs instructions, resuspended in Opti-MEM (Gibco), aliquoted and frozen at â80â°C for future use. B2M-targeted VSVG Cas9-EDVs were produced as described above. The mNeonGreen lentivirus stock was pre-titered on HEK293T cells; Cas9-EDV and mNeonGreen lentivirus samples were diluted in Opti-MEM in a twofold dilution series. Aliquots of 50âµl of each dilution series were mixed with 15,000 HEK293T cells in 50âµl cDMEM in triplicate in a 96-well plate. For the lentiviral sample, the percentage of mNeonGreen+ cells was assessed by flow cytometry 3âdays post transduction. Wells in which the percent of mNeonGreen+ cells was â¤25% were used to calculate the transducing units per ml. The genome editing activity of the Cas9-EDV stock was pre-titered similarly, except that B2M expression was assessed by flow cytometry at 3âdays post treatment to calculate Cas9-EDV volume that resulted in approximately 50% of cells negative for B2M expression.
The HIV-1 capsid inhibitor GS-CA1 (Gilead Sciences) was diluted to a working stock of 100âµM using DMSO. A total of 15,000 HEK293T cells were transduced with mNeonGreen lentivirus or B2M-targeting Cas9-EDVs and simultaneously treated with 0, 0.5, 5 or 25ânM GS-CA1 in a total well volume of 100âµl (0.05% DMSO final). mNeonGreen and B2M expression were assessed by flow cytometry 3âdays post treatment. As a control, B2M sgRNA and Cas9 protein (IDT) were complexed at a 2:1 ratio for 15âmin at 37â°C, and 50âpmol Cas9 RNPs were nucleofected into 200,000 HEK293T cells using the SF Cell Line 4D-Nucleofector Kit and 4D-Nucleofector instrument (Lonza), using pulse code CM-130. Post nucleofection, cells were brought up to 100âµl with pre-warmed cDMEM and incubated at 37â°C for 15âmin. Nucleofected cells were plated at 15,000 per well of a 96-well plate and treated with 25ânM GS-CA1, 0.05% DMSO or Opti-MEM. B2M expression was assessed by flow cytometry 3âdays post nucleofection.
Humanized mouse experiments
All animal studies and procedures were conducted in accordance with the established National Institutes of Health guidelines for animal care and use and were approved by the UC Berkeley Animal Care and Use Committee. All experimental and control animals were housed under the same conditions as approved by the Berkeley Office of Laboratory Animal Care. Mice were housed at ambient room temperature in a humidity-controlled animal facility with free access to water and food. Mice were maintained on a 12:12âh light:dark cycle (lights on from 07:00 to 19:00 h).
Human peripheral blood mononuclear cell-engrafted NSG mice (745557, 6â8 weeks of age) were purchased from Jackson Laboratory. âExperiment 1â and âexperiment 2â mouse cohorts were engrafted with cells from unique human donors. Following anesthesia induction with 2â3% isofluorane, 100âµl of Cas9-EDVs, lentivirus or PBS was administered by retro-orbital injection. Mice were euthanized with CO2 10âdays post treatment and the spleen and liver were dissected. See âImmunofluorescent staining and imagingâ for downstream liver sample processing. Single-cell suspensions of spleen were prepared by gently bursting the organ in 4âml DMEM (Corning) in a well of a 6-well dish using the back of a 3âml syringe (Thermo Fisher). Splenocytes were passed through a 100âμm cell mesh (Corning), brought up to 25âml with DPBS (Gibco) and spun at 300Ãg for 10âmin. Erythrocytes were lysed by resuspending splenocytes in 5âml 1à BD Pharm Lyse lysing solution (BD Biosciences) for 5âmin before being brought up to 25âml with DPBS. Cells were then pelleted at 300Ãg for 10âmin, resuspended in 10âml DPBS and counted using a Countess 3 automated cell counter (Thermo Fisher). Cells were cryopreserved in freeze media (Bambanker) for downstream cell sorting. For flow cytometry analysis, CD45+ cells were isolated from splenocytes using the EasySep Release Human CD45 Positive Selection Kit for Humanized Mouse Samples (StemCell Technologies) on an EasySep EasyEights Magnet (StemCell Technologies) according to the manufacturerâs instructions. Immunophenotyping was performed using anti-human CD4-FITC, anti-human CD4-PE-Cyanine7, anti-human CD8-PE-Cyanine7 and anti-human CD19-FITC (Supplementary Table 3), and cells were assessed for CAR-2A-mCherry expression using an Attune NxT flow cytometer with 96-well autosampler (Thermo Fisher). For cell sorting, cryopreserved splenocytes were thawed and stained with anti-human CD4-FITC and anti-human CD8-FITC (Supplementary Table 3) in PBS containing 1% BSA, and an SH800S cell sorter (Sony Biotechnology) was used to sort mCherry+ and mCherryâ primary human Tâcells that were either expressing CD4 or CD8.
Flow cytometry
Cells were stained with anti-human B2M-APC or anti-human B2M-PE (Supplementary Table 3) in PBS containing 1% BSA, and an Attune NxT flow cytometer with 96-well autosampler (Thermo Fisher) was used for flow cytometry analysis. Ligand expression was confirmed for engineered HEK293T cells using anti-human CD28-PE, anti-human CD20-PE, anti-human CD4-PE-Cyanine7 and anti-human CD19-PE (Supplementary Table 3). Tâcell immunophenotyping was performed using anti-human CD3-FITC, anti-human CD4-FITC and anti-human CD8-PE-Cyanine7 (Supplementary Table 3). CD25 expression was assessed using anti-human CD25-APC (Supplementary Table 3). Data analysis was performed using FlowJo v.10.7.1 (FlowJo).
Amplicon sequencing to assess genome editing
Next-generation sequencing was used to detect on-target genome editing in EGFP+ and EGFPâ sorted HEK293T cells. Genomic DNA was extracted using QuickExtract (Lucigen) as previously described22. PrimeStar GXL DNA polymerase (Takara Bio) was used to amplify the Cas9 RNP target site using the following primers: B2M, 5â²-GCTCTTCCGATCTaagctgacagcattcgggc and 5â²-GCTCTTCCGATCTgaagtcacggagcgagagag; PDCD1, 5â²-GCTCTTCCGATCTccgaccccacctacctaaga and 5â²-GCTCTTCCGATCTgacagtttcccttccgctca. The resulting PCR products were cleaned up using magnetic SPRI beds (UC Berkeley DNA Sequencing Facility). The Innovative Genomics Institute Next-Generation Sequencing Core performed library preparation and sequencing using a MiSeq v2 Micro 2Ã150bp kit (Illumina). Reads were trimmed and merged (Geneious Prime, v.2022.0.1) and analyzed with CRISPResso2 (http://crispresso.pinellolab.partners.org/login).
NextSeq P2 sequencing of sorted mouse cells
Genomic DNA was extracted from sorted mCherry+ and mCherryâ primary human Tâcells using the QIAamp DNA Mini Kit (Qiagen) according to the manufacturerâs instructions. PrimeStar GXL DNA polymerase (Takara Bio) was used to amplify the TRAC Cas9 RNP target site using primers 5â²-GCTCTTCCGATCTggggcaaagagggaaatgaga and 5â²-GCTCTTCCGATCTactttgtgacacatttgtttgag. The resulting PCR products were cleaned up using magnetic SPRI beds (UC Berkeley DNA Sequencing Facility). The Innovative Genomics Institute Next-Generation Sequencing Core performed library preparation and sequencing using a NextSeq 1000/2000 P2 v3 2Ã150bp kit (Illumina). Reads were trimmed and merged (Geneious Prime, v.2022.0.1) and analyzed with CRISPResso2 (http://crispresso.pinellolab.partners.org/login).
TCR sequencing
Splenocytes from three Cas9-EDV-treated mice and three lentivirus-treated mice in humanized mouse experiment 2 were sorted into mCherry+ and mCherryâ primary human Tâcells using an SH800S cell sorter (Sony Biotechnology). RNA was extracted from sorted cells using the RNeasy Mini Kit (Qiagen) according to the manufacturerâs instructions. TCR a/b libraries were prepared from each sample using the SMART-Seq Human TCR (with UMIs) kit (Takara Bio) according to the manufacturerâs instructions. Samples were pooled and sequenced on an Illumina MiSeq using 2Ã300âbp paired-end chemistry and MiSeq Reagent Kit v.3 (MS-102-3003, Illumina), yielding an average sequencing depth of 1.75 million reads. FASTQ files were analyzed with Cogent NGS Immune Profiler Software (v.1.5), using a UMI cutoff of 3. Clonotypes were visualized using Cogent NGS Immune Viewer (v.1.0) and a custom Python script.
Immunofluorescent staining and imaging
Humanized mice were killed with CO2 and livers were dissected. Livers were fixed in 4% paraformaldehyde (Electron Microscopy Sciences) for 24âh and transferred to 30% sucrose (Fisher Chemical). After 3âdays, livers were embedded into cryoblocks using the Tissue Plus O.C.T. Compound (Fisher HealthCare). Liver sections (20âµm) were cut with the Leica CM 3050âS Cryostat, placed on Superfrost Plus microscope slides (Fisher Scientific) and stored at â80â°C.
Sections were blocked with a buffer including 5% normal goat serum (Sigma-Aldrich), 2% BSA (Sigma-Aldrich), 0.03% Triton X-100 (Fisher Scientific) and 0.05% sodium azide (Sigma-Aldrich) for 1âh at room temperature. Sections were stained for 2âh at room temperature with primary antibodies as follows: mouse anti-β-catenin and rat anti-F4/80; then mouse anti-β-catenin and rabbit anti-hCD3 (Supplementary Table 3). Tissue sections were washed three times with 1à PBS and stained with secondary antibodies for 1âh (Supplementary Table 3). Tissue sections were washed again three times with 1à PBS and treated with DAPI (Sigma-Aldrich) for 10âmin. Then, sections were covered with cover glass slip (Micro Cover Glass, VWR) with Fluoromount-G (Southern Biotech). For the negative control, the sections were treated with secondary antibodies only and DAPI (Sigma-Aldrich).
The images of stained liver sections were taken at Ã20 magnification with the Echo Revolve fluorescent microscope and obtained using the associated software (ECHOPro) through DAPI, FITC, Texas Red and CY5 channels.
Immunogold staining
Cas9-EDVs with CD19 scFvs with either strep or myc epitope tags were produced as stated above. Aliquots of 25âml of the Cas9-EDVs were concentrated using ultracentrifugation at 100,000Ãg for 75âmin through 9âml of a 10% v/v iodixanol cushion (StemCell Technologies) in 1à PBS. The supernatant was removed and the Cas9-EDVs were resuspended in 100âµl of 10âmM Tris-HCl pH 7.5, 150âmM NaCl. Cas9-EDVs were stored at 4â°C and used within 48âh. Carbon Type-B copper transmission electron microscopy grids (Ted Pella) were glow-discharged. Then, 5âµl of the EDVs were applied to the carbon side of the grid and incubated for 3âmin. Excess sample was removed by blotting with Kimwipes. The grids were blocked for 2âmin using 15âµl of 10âmM Tris-HCl pH 7.5, 150âmM NaCl and 1% w/v BSA (Sigma-Aldrich) (blocking buffer). The excess blocking buffer was removed by blotting with Kimwipes. Anti-myc antibody (15âµl of 50âµgâmlâ1; Supplementary Table 3) was applied to the grid and incubated for 30âmin at room temperature. A lid was used to cover the grids and prevent them from drying out. The grids were subsequently washed five times with 15âµl of blocking buffer. Then 12âµl of 1/10 diluted goat anti-mouse 6-nm immunogold conjugates (Electron Microscopy Sciences) was applied to the grids and incubated for 30âmin at room temperature. The grids were subsequently washed with 15âµl of blocking buffer four times and with ultrapure water once. Uranyl formate (0.7%, 5âµl; Ted Pella) was applied to stain and fix the samples. Excess stain was removed by blotting with Kimwipes. The EDVs were visualized using a FEI Tecnai T12 transmission electron microscope operating at 120âkV and a Gatan UltraScan 895 4k CCD (UC San Francisco EM Core).
Dynamic light scattering
Cas9-EDVs and LVs were assessed using a Zetasizer Nano ZS (Malvern Panalytical) instrument with plastic micro cuvettes (Malvern Panalytical). Cas9-EDVs and LVs were produced as described above, except that 6â18âh post transfection of Lenti-X cells, media was changed into 5âml Opti-MEM instead of 10âml per 10âcm tissue culture dish. Two days post media change, Cas9-EDV-containing or LV-containing supernatants were collected and passed through a 0.45âµm PES syringe filter (VWR) without further concentration. EDV and LV particle numbers were measured and normalized using the QuickTiter Lentivirus Titer Kit (Lentivirus-Associated HIV p24) as described above. For dynamic light scattering measurements, 40âμl of normalized Cas9-EDV and LV were prepared, and particle size was measured at 25â°C. As a control, 100ânm diameter NanoXact Gold Nanospheres â Bare (Citrate) (nanoComposix) were included. Data were analyzed by intensity using the Zetasizer analysis software.
Quantitative RTâPCR of B2M sgRNA
Cas9-EDVs containing gRNA targeting the B2M gene were produced and concentrated as described above, and RNA was extracted from 150âμl of Cas9-EDVs using the NucleoSpin RNA Virus Kit (Takara Bio) according to the manufacturerâs instructions. Quantitative RTâPCR (RTâqPCR) was performed using the PrimeTimeTM One-Step RTâqPCR Master Mix (IDT) according to the manufacturerâs instructions on a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher). The qPCR primers were ordered as a custom TaqMan Small RNA Assay to detect the B2M sgRNA target sequence GAGUAGCGCGAGCACAGCUAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Thermo Fisher, Assay ID CTWCW3V).
Biodistribution experiment
A total of 100âµl of lentivirus displaying either VSVG or CD19+VSVGmut, or PBS was administered to C57BL/6 mice (000664, Jackson Laboratory, 9â10 weeks of age) by retro-orbital injection following anesthesia induction with 2â3% isofluorane. Mice were killed with CO2 30âmin post treatment and spleen, kidney, heart, liver, lung and blood were collected. Spleen, kidney, heart, liver and lung samples (15âmg each) were collected and stored in 1à DNA/RNA Shield (Zymo Research). Blood samples were drawn into tubes pre-coated with 0.5âM EDTA and were then separated into plasma and red blood cells by carefully layering blood diluted with PBS containing 2% FBS on top of Percoll density gradient media (Cytiva) and centrifuging at 800Ãg for 20âmin. Plasma and red blood cell layers were extracted and mixed with an equal volume of 2à DNA/RNA Shield (Zymo Research). RNA was extracted from tissue samples using the Quick-RNA Viral Kit (Zymo Research) according to the manufacturerâs instructions. Lentivirus titers were measured using the Lenti-X qRTâPCR Titration Kit (Takara Bio) on a QuantStudio 3 Real-Time PCR System (Thermo Fisher).
Statistical analysis
Statistical analysis was performed using Prism v.9. Statistical details for all experiments, including the value and definition of sample sizes and error bars, can be found in the figure legends.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Online content
Any methods, additional references, Nature Portfolio reporting summaries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contributions and competing interests; and statements of data and code availability are available at 10.1038/s41587-023-02085-z.
Supplementary information
Supplementary Figs. 1â8.
Information on single-chain variable fragment targeting molecule sequences.
Transgene sequences for Cas9-EDV production.
Information on flow cytometry antibodies used in this study.
Statistical source data for supplementary figures.
Source data
Statistical source data for main figures.
Acknowledgements
We thank all members of the Doudna laboratory for their thoughtful input on this project, particularly C. Tsuchida and A. Stahl. We thank N. Krishnappa and the IGI NGS Core for assistance with next-generation sequencing and L. Vo for help with human CD34+ cell experiments. J. Cate, M. Kan, E. Lin Shiao, K. Wasko, A. Syed and R. Wilson provided helpful comments on the manuscript. We also thank W. Sundquist for helpful discussions and the suggestion to use GS-CA1 for capsid disruption and thank S. Yant (Gilead Sciences) for providing GS-CA1. Funding was provided by the Centers for Excellence in Genomic Science of the NIH (grant no. RM1HG009490), the Somatic Cell Genome Editing Program of the NIH Common Fund (grant no. U01AI142817-02), NIH CASEPR (grant no. U19 64542), NIH HARC (grant no. 64340), DOE/LLNL (grant no. 63645), the Emerson Collective and the Howard Hughes Medical Institute. J.R.H. is supported by NIH/NIGMS (grant no. K99GM143461-01A1) and the Jane Coffin Childs Memorial Fund for Medical Research. W.N. is supported by the Natural Sciences and Engineering Research Council of Canada (NSERC PDF-578176-2023).
Author contributions
J.R.H. and J.A.D. conceptualized this work. J.R.H., E.C., B.S.P., C.S.E. and J.A.D. developed the methodology. M.T. developed the software. J.R.H., E.C., B.S.P., C.S.E., M.H.K. and W.N. carried out the investigation. J.R.H., E.C., B.S.P., M.H.K. and M.T. created visual representations. J.R.H., E.C., B.S.P. and J.A.D. wrote the initial draft and J.R.H., E.C., B.S.P., C.S.E., M.H.K., M.T., W.N. and J.A.D. reviewed and edited the manuscript. J.R.H. and J.A.D. were responsible for funding acquisition and project administration.
Peer review
Peer review information
Nature Biotechnology thanks the anonymous reviewers for their contribution to the peer review of this work.
Data availability
Sequencing data have been deposited in the National Institutes of Health NCBI SRA (BioProject PRJNA1023251) and GEO (accession number GSE235643) repositories51,52. Flow cytometry raw data files are available upon request. All other data are available in the main text or the Supplementary Information. Plasmids generated in this study are available on Addgene.
Code availability
Code generated for this work has been deposited online and is publicly available on Github (10.5281/zenodo.8417852)53.
Competing interests
The Regents of the University of California have patents issued and/or pending for CRISPR technologies (on which J.A.D. is an inventor) and delivery technologies (on which J.A.D. and J.R.H. are co-inventors). J.A.D. is a co-founder of Caribou Biosciences, Editas Medicine, Scribe Therapeutics, Intellia Therapeutics and Mammoth Biosciences. J.A.D. and J.R.H. are co-founders of Azalea Therapeutics. J.A.D. is a scientific advisory board member of Vertex, Caribou Biosciences, Intellia Therapeutics, Scribe Therapeutics, Mammoth Biosciences, Algen Biotechnologies, Felix Biosciences, The Column Group and Inari. J.A.D. is Chief Science Advisor to Sixth Street, a Director at Johnson & Johnson, Altos and Tempus, and has research projects sponsored by AppleTree Partners and Roche. All other authors have no competing interests.
Footnotes
Publisherâs note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
The online version contains supplementary material available at 10.1038/s41587-023-02085-z.
References
- 1.Wilson, R. C. & Gilbert, L. A. The promise and challenge of in vivo delivery for genome therapeutics. ACS Chem. Biol.13, 376â382 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.van Haasteren, J. et al. The delivery challenge: fulfilling the promise of therapeutic genome editing. Nat. Biotechnol.38, 845â855 (2020). [DOI] [PubMed] [Google Scholar]
- 3.Raguram, A., Banskota, S. & Liu, D. R. Therapeutic in vivo delivery of gene editing agents. Cell185, 2806â2827 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Stadtmauer, E. A. et al. CRISPR-engineered T cells in patients with refractory cancer. Science367, eaba7365 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Frangoul, H. et al. CRISPRâCas9 gene editing for sickle cell disease and β-thalassemia. N. Engl. J. Med.384, 252â260 (2021). [DOI] [PubMed] [Google Scholar]
- 6.Segel, M. et al. Mammalian retrovirus-like protein PEG10 packages its own mRNA and can be pseudotyped for mRNA delivery. Science373, 882â889 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Editas Medicine Editas Medicine announces positive initial clinical data from ongoing phase 1/2 BRILLIANCE clinical trial of EDIT-101 for LCA10; https://ir.editasmedicine.com/news-releases/news-release-details/editas-medicine-announces-positive-initial-clinical-data-ongoing
- 8.Banskota, S. et al. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Cell185, 250â265.e16 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gillmore, J. D. et al. CRISPRâCas9 in vivo gene editing for transthyretin amyloidosis. N. Engl. J. Med.385, 493â502 (2021). [DOI] [PubMed] [Google Scholar]
- 10.Veiga, N. et al. Cell specific delivery of modified mRNA expressing therapeutic proteins to leukocytes. Nat. Commun.9, 4493 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Cheng, Q. et al. Selective organ targeting (SORT) nanoparticles for tissue-specific mRNA delivery and CRISPRâCas gene editing. Nat. Nanotechnol.15, 313â320 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Cronin, J., Zhang, X.-Y. & Reiser, J. Altering the tropism of lentiviral vectors through pseudotyping. Curr. Gene Ther.5, 387â398 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Buchholz, C. J., Friedel, T. & Büning, H. Surface-engineered viral vectors for selective and cell type-specific gene delivery. Trends Biotechnol.33, 777â790 (2015). [DOI] [PubMed] [Google Scholar]
- 14.Lévy, C., Verhoeyen, E. & Cosset, F.-L. Surface engineering of lentiviral vectors for gene transfer into gene therapy target cells. Curr. Opin. Pharmacol.24, 79â85 (2015). [DOI] [PubMed] [Google Scholar]
- 15.Maroun, J. et al. Designing and building oncolytic viruses. Future Virol.12, 193â213 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Naldini, L. et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science272, 263â267 (1996). [DOI] [PubMed] [Google Scholar]
- 17.Finkelshtein, D., Werman, A., Novick, D., Barak, S. & Rubinstein, M. LDL receptor and its family members serve as the cellular receptors for vesicular stomatitis virus. Proc. Natl Acad. Sci. USA110, 7306â7311 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Nikolic, J. et al. Structural basis for the recognition of LDL-receptor family members by VSV glycoprotein. Nat. Commun.9, 1029 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Dobson, C. S. et al. Antigen identification and high-throughput interaction mapping by reprogramming viral entry. Nat. Methods19, 449â460 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Yu, B. et al. Engineered cell entry links receptor biology with single-cell genomics. Cell185, 4904â4920.e22 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Choi, J. G. et al. Lentivirus pre-packed with Cas9 protein for safer gene editing. Gene Ther.23, 627â633 (2016). [DOI] [PubMed] [Google Scholar]
- 22.Hamilton, J. R. et al. Targeted delivery of CRISPRâCas9 and transgenes enables complex immune cell engineering. Cell Rep.35, 109207 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Mangeot, P. E. et al. Genome editing in primary cells and in vivo using viral-derived Nanoblades loaded with Cas9-sgRNA ribonucleoproteins. Nat. Commun.10, 45 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Indikova, I. & Indik, S. Highly efficient âhit-and-runâ genome editing with unconcentrated lentivectors carrying Vpr.Prot.Cas9 protein produced from RRE-containing transcripts. Nucleic Acids Res.48, 8178â8187 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lyu, P. et al. Adenine base editor ribonucleoproteins delivered by lentivirus-like particles show high on-target base editing and undetectable RNA off-target activities. CRISPR J4, 69â81 (2021). [DOI] [PubMed] [Google Scholar]
- 26.Lu, Z. et al. Lentiviral capsid-mediated Streptococcus pyogenes Cas9 ribonucleoprotein delivery for efficient and safe multiplex genome editing. CRISPR J4, 914â928 (2021). [DOI] [PubMed] [Google Scholar]
- 27.Gee, P. et al. Extracellular nanovesicles for packaging of CRISPRâCas9 protein and sgRNA to induce therapeutic exon skipping. Nat. Commun.11, 1334 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Rafiq, S., Hackett, C. S. & Brentjens, R. J. Engineering strategies to overcome the current roadblocks in CAR T cell therapy. Nat. Rev. Clin. Oncol.17, 147â167 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Lou, H. & Cao, X. Antibody variable region engineering for improving cancer immunotherapy. Cancer Commun.42, 804â827 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Lerner, G., Weaver, N., Anokhin, B. & Spearman, P. Advances in HIV-1 assembly. Viruses14, 478 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Yant, S. R. et al. A highly potent long-acting small-molecule HIV-1 capsid inhibitor with efficacy in a humanized mouse model. Nat. Med.25, 1377â1384 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Selyutina, A. et al. GS-CA1 and lenacapavir stabilize the HIV-1 core and modulate the core interaction with cellular factors. iScience25, 103593 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Johnson, S. et al. Mass spectrometry analysis reveals differences in the host cell protein species found in pseudotyped lentiviral vectors. Biologicals52, 59â66 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Cheung, A. S., Zhang, D. K. Y., Koshy, S. T. & Mooney, D. J. Scaffolds that mimic antigen-presenting cells enable ex vivo expansion of primary T cells. Nat. Biotechnol.36, 160â169 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Walter, R. B., Boyle, K. M., Appelbaum, F. R., Bernstein, I. D. & Pagel, J. M. Simultaneously targeting CD45 significantly increases cytotoxicity of the anti-CD33 immunoconjugate, gemtuzumab ozogamicin, against acute myeloid leukemia (AML) cells and improves survival of mice bearing human AML xenografts. Blood111, 4813â4816 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Chen, A. & Moy, V. T. Cross-linking of cell surface receptors enhances cooperativity of molecular adhesion. Biophys. J.78, 2814â2820 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Paul, D. et al. Cell surface protein aggregation triggers endocytosis to maintain plasma membrane proteostasis. Nat. Commun.14, 947 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Globerson Levin, A., Rivière, I., Eshhar, Z. & Sadelain, M. CAR T cells: building on the CD19 paradigm. Eur. J. Immunol.51, 2151â2163 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Dimitri, A., Herbst, F. & Fraietta, J. A. Engineering the next-generation of CAR T-cells with CRISPRâCas9 gene editing. Mol. Cancer21, 78 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Rurik, J. G. et al. CAR T cells produced in vivo to treat cardiac injury. Science375, 91â96 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Parayath, N. N., Stephan, S. B., Koehne, A. L., Nelson, P. S. & Stephan, M. T. In vitro-transcribed antigen receptor mRNA nanocarriers for transient expression in circulating T cells in vivo. Nat. Commun.11, 6080 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Smith, T. T. et al. In situ programming of leukaemia-specific T cells using synthetic DNA nanocarriers. Nat. Nanotechnol.12, 813â820 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Shao, L. et al. Genome-wide profiling of retroviral DNA integration and its effect on clinical pre-infusion CAR T-cell products. J. Transl. Med.20, 514 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Chandler, R. J., Sands, M. S. & Venditti, C. P. Recombinant adeno-associated viral integration and genotoxicity: insights from animal models. Hum. Gene Ther.28, 314â322 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Nawaz, W. et al. AAV-mediated in vivo CAR gene therapy for targeting human T-cell leukemia. Blood Cancer J.11, 119 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Agarwal, S., Weidner, T., Thalheimer, F. B. & Buchholz, C. J. In vivo generated human CAR T cells eradicate tumor cells. Oncoimmunology8, e1671761 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Pfeiffer, A. et al. In vivo generation of human CD19-CAR T cells results in B-cell depletion and signs of cytokine release syndrome. EMBO Mol. Med.10, e9158 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.van der Jagt, R. H. et al. Localization of radiolabeled antimyeloid antibodies in a human acute leukemia xenograft tumor model. Cancer Res.52, 89â94 (1992). [PubMed] [Google Scholar]
- 49.Hill, Z. B., Martinko, A. J., Nguyen, D. P. & Wells, J. A. Human antibody-based chemically induced dimerizers for cell therapeutic applications. Nat. Chem. Biol.14, 112â117 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Muller, Y. D., Nguyen, D. P., Ferreira, L. M. R., Ho, P. & Raffin, C. The CD28-transmembrane domain mediates chimeric antigen receptor heterodimerization with CD28. Frontiers in Immunology12, 639818 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Hamilton, J. R. et al. In vivo human T cell engineering with enveloped delivery vehicles (Datasets. Sequence Read Archive); https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1023251 [DOI] [PMC free article] [PubMed]
- 52.Hamilton, J. R. et al. Programmable enveloped delivery vehicles for human genome engineering in vivo (Datasets. Gene Expression Omnibus); https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE235643
- 53.Hamilton, J. R. et al. EDV TCR clonotype analysis (Zenodo) 10.5281/zenodo.8417852
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary Figs. 1â8.
Information on single-chain variable fragment targeting molecule sequences.
Transgene sequences for Cas9-EDV production.
Information on flow cytometry antibodies used in this study.
Statistical source data for supplementary figures.
Statistical source data for main figures.
Data Availability Statement
Sequencing data have been deposited in the National Institutes of Health NCBI SRA (BioProject PRJNA1023251) and GEO (accession number GSE235643) repositories51,52. Flow cytometry raw data files are available upon request. All other data are available in the main text or the Supplementary Information. Plasmids generated in this study are available on Addgene.
Code generated for this work has been deposited online and is publicly available on Github (10.5281/zenodo.8417852)53.





